Huntingtin exon 1 deletion does not alter

Introduction Huntington’s disease (HD) is a neurodegenerative disorder with an autosomal dominant trait and is caused by unusual expansion of CAG DNA triplet repeats in exon 1 of the IT15 gene, which is translated to an expanded polyglutamine (polyQ) repeat in huntingtin (HTT), a 350-kDa protein whose function remains to be fully investigated (MacDonald et al., 1993; Saudou and Humbert, 2016). The expanded polyQ repeat in mutant HTT contains more than 36 glutamines and leads to a progressive loss of motor coordination and function, chorea, and eventually death within 10 to 15 years after the onset of the disease in midlife (Ross and Tabrizi, 2011; Bates et al., 2015). Despite widespread distribution of mutant HTT throughout the body and brain, mutant HTT causes selective neuronal loss in the brain with the preferential death of GABAergic medium-sized spiny neurons in the neostriatum and large neurons in layer VI of the cerebral cortex (Ross and Tabrizi, 2011; Bates et al., 2015). Like other eight polyglutamine diseases, including SCA 1, 2, 3, 6, 7, 17. Dentatorubral-pallidoluysian atrophy (DRPLA), and spinobulbar muscular atrophy (SBMA), HD currently has no cure. Because mutant HTT can affect a variety of cellular functions, eliminating mutant HTT would be the most effective way to treat HD (Caron et al., 2018; Tabrizi et al., 2020). To this end, gene editing has been used to remove the expanded CAG repeats that is localized in exon 1 of HTT or to selectively delete the mutant allele (Liu et al., 2016; Yang et al., 2017; Dabrowska et al., 2018). However, it would be challenging to just remove the polyQ domain without disrupting N-terminal HTT. On the other hand, removing the exon 1, which consists of a N17 domain and polyQ followed by PRR (Proline-rich region) domain, would be less difficult, but it remains to be investigated whether the exon 1 of HTT is an indispensable part for the essential function of HTT. Previous studies have shown that HTT exon 1 plays a significant role in membrane anchoring, protein interaction, and protein complex formation (Li and Li, 2004; Michalek et al., 2013; Tao et al., 2019; Vieweg et al., 2021). N17 amino acids in exon 1 are well conserved across species and are thought to be important for HTT’s function as well as the toxicity of mutant HTT. In support of this, N17 amino acids can markedly modify the toxicity of mutant HTT and its nuclear localization (Cornett et al., 2005; Gu et al., 2009; Arndt et al., 2019; Chiki et al., 2021; Vieweg et al., 2021). However, growing evidence indicates that mice lacking polyQ domain and most part of exon 1 of HTT do not show obviously abnormal growth and behaviors (Zheng et al., 2010; André et al., 2017; Yang et al., 2020; Braatz et al., 2021). Given that HTT is a multifaced protein and is essential for the early development of mice (Saudou and Humbert, 2016), it is important to investigate whether HTT’s normal function is dependent on its N-terminal exon 1 region, and addressing this issue is important for treating HD. In this study, we used a knock-in mouse model with deletion of the mouse Htt exon 1 to examine the subcellular distribution of Htt, neuronal development, autophagy protein expression, and gene transcription. Our results show no significant differences between wild type mice and mutant mice without Htt exon 1, suggesting that exon 1 in Htt gene can be safely removed to eliminate neurotoxicity of the expanded polyQ in treating HD. Materials and Methods Mouse maintenance and breeding Mice (C57BL/6) were bred and maintained in the animal facility at Jinan University under specific pathogen-free conditions in accordance with institutional guidelines of the Animal Care and Use Committee at Jinan University. All mice were maintained on a 12:12 h light/dark cycle (lights off at 9 p.m.). The temperature was maintained at 22 ± 1°C with relative humidity (30%–70%). The studies followed the protocol approved by the Animal Care and Use Committee at Jinan University. To stress mice, starvation was induced by removing food for exactly 24 h, with sufficient water supply. The D177 mice, with a deletion of 177 bp in exon 1 of Htt gene, was generated in our previous study (Yang et al., 2020). The gRNA sequences used to target the mouse Htt exon 1 were (PAM site in lowercase): T1: cccTGGAAAAGCTGATGAAGGC; T3: ccaGGTCCGGCAGAGGAACCGC, and the primers used to genotype KI mice were: S1, ACTGCTAAGTGGCGCCGCGTAG (mouse genomic HTT 98–118) and A1, AGGAGGTAACCCTAGAGATCT CTGC (mouse genomic HTT 700–724; Yang et al., 2017). Cell culture and immunofluorescence Striatal neurons were obtained from the brain tissues of P1 (postnatal day 1) mouse. The brain tissues were treated with HBSS (Ca2+ free and homemade) containing 0.125 mg/ml Trypsin (GibcoTM #25200056) and then passed through 1 ml tip for 20 times, followed by centrifugation of the cells at 1,000× g for 5 min. Cells were resuspended in the medium (Neurobasal A BRL#10888-022 with 0.4 mM L-glutamine BRL#25030-081, 1% fetal bovine serum, 2% B27 GibcoTM #A3582801, and 1% penicillin-streptomycin mixture GibcoTM #15140122) and then set in the tissue culture plates pre-coated with 0.1 mg/ml poly-D-lysine. After 14 days, the primary cultured neurons were fixed with 4% paraformaldehyde in PBS (phosphate buffered saline, 137 mM NaCl, 2.7 mM KCl, 10 mM NaH2PO4 and 2 mM KH2PO4) for 10 min at room temperature. The fixed cells were washed with PBS for three times (5 min each time), and then blocked in 3% BSA/2% donkey serum/0.2% Triton X-100 in PBS for 1 h. After washes with PBS three times, the cells were incubated in blocking buffer with 0.1% Triton X-100 and primary antibody at 4°C overnight. The primary antibody was then removed, and the cells were washed with PBS, followed by adding secondary antibody (in 3% BSA/PBS) with DAPI (4’,6-Diamidino-2-phenylindole dihydrochloride, Sigma #D9542) onto the cells for 30 min at 4°C before examination. Western blotting analysis For Western blotting, mouse brain tissue was dissected and lysed in ice-cold RIPA lysis buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 1 mM EDTA pH 8.0, 0.1% SDS, 0.5% Sodium Deoxycholate and 1% triton X-100) containing halt protease inhibitor cocktail (ThermoScientific #78429), 2 mM Na3VO4, 10 mM NaF, and PMSF. The lysates were incubated on ice for 30 min and then sonicated for 10 s. For western blotting analysis, equal amounts of protein from the whole lysates were resolved by 4%–20% or 4%–12% gels (BeyoGelTM SDS-PAGE Precast Gel, #P0056 and #P0057) or 4% or 6% homemade tris-glycine SDS-PAGE gels for detecting full-length Htt. The proteins in SDS gel were transferred to a nitrocellulose membrane (0.2 μm, Millipore #ISEQ00010) that was then incubated with appropriate primary antibodies using the dilution as indicated in Table 1). Table 1. Antibodies used in the study. Subcellular fractionation and Western blotting The whole fresh brains of D177 and wild-type mouse were minced with a pair of scissors to 2–4 nm pieces, resuspend in 6 volumes of solution A in a homogenizer (Glass, loose type) and homogenized in 0.25 M sucrose, 2 mM Tris-HCl pH 7.4, 1 mM MgCl2, 100 mM NaCl, 1 mM K2HPO4 pH 7.0, 1 mM EDTA, 1× protease inhibitor, phosphates inhibitors (2 mM sodium orthovanadate , Na3VOs, and 10 mM Sodium Fluoride NaF)
Read More